Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20b11
Contig Information
Length 706 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20b11   
Homology (BLAST) Top Hit hypothetical protein OsI_07988 [Oryza sativa Indica Group]
Score 481
Evalue 1.30535e-46
Total Hit Count 323
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20b11
AATGGTTTAACATATCACGTTCATGAGTTATGGGGTAAAGGAAGATGCACATATATGTACATATACTAATAGAAACATGTGCCTTCCTCCAGTTGCAAGC
CGGCCATTCTTGTCATCCTAGGCAGGACCCTCAGAAAATCTAATGTAAGCCTGCCTGCATCTAGTGCCCATCTCAACGGTCACGACGCCCGTGTCGGTCA
TAGTCCCTAGAACTATCCCTTGGGGAACGTGACCTTCGGCGGCTCCTCGAATCATAGCTACGAGATCTCCCTGATTCTTTATCATGGCCATATCTACTTT
CTCTGTCATGGTAGCGATCATGGCTACTTCTACGGTCATAATCCCTGTGCCTGTCACGACTGCTGCTTCGATCTCCTCTATGACGGTCCCTGCTTGATGC
TCTATCACATTCTGTGCTCCTTTCCTTGGATCTTCTGTCATGTTCAGTTCGGTCCACCTTGCGCCTTTTGTTTTTCTCTTCCTGCAGTTCAGACAACTTC
TCCCGTATTAGCATATAACCCATATGGAGTTTCCCTCCGAAATGATCTGCTAAACGCCGGTCACTGTCATACACGCTCAAGAATGCTCCACATATGTCAC
ACAGGCGCAACTTTTGATCAGTAATTTGAACGTGAGTGGATATTTTTGCAGAGTCAGGAACAGGCTGTGGCCGCGCACCCAGCTTCTTCANAGCTTCTGC
TTCATC
page-top