Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10p16
Contig Information
Length 616 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10p16   
Homology (BLAST) Top Hit hypothetical protein UM02447.1 [Ustilago maydis 521] >gi|46098252|gb|EAK83485.1| hypothetical protein UM02447.1 [Ustilago maydis 521]
Score 77
Evalue 6.67245
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10p16
TCGAAGCATGGNCNTATTAGTTCTTACCACAGGCTGAACAAAAGGAAACTCTTTAAAGACGGGAGACTACATGTACAGCAACTGACCCTNTGTTCCTGCT
AGNTAGCTAGCTATGCTACAGACTTTTGCCTACAGGNAGGCACGATGGAGGAGCTTTGCACCCTTCCCTAAATTCTTCTACTGCCTCCNAAGTGATCNCC
ATGAATCATTANAGGAGAATGATAGAAAAAGAAANCAGAACTGCTTCCTATATAGATAGATACCACTGCGTTCATTTTCATCCTTCTTGGANNGACAGAC
GTGGAGGGACAGTCAGTCCTGGATCNCAAACAANACCAGAGGAACCATTCCACCAAGCGAACAGCATGCATCTCACACCTCCGGCCGACCAACCAATAGT
ACGGGGGCACCCAACTAGGGACGCTAATCAGAATCTGACTCAATAGCTAGTACGGATTTTGGTCGAACTGACCGTGGCTGACCAGACNGTGAGGAAGTGC
CACCAGATCCATCCCCAGCAAAGTCGTCGTCGTCATTGCCACTCATGAGAACTGAAGCATCTAAAGATGTTATTTCATTCGCAGGGTTCTTCCTTTTCCG
GGAAAGTGTTTTTGGC
page-top