Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10g23
Contig Information
Length 695 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10g23   
Homology (BLAST) Top Hit minichromosomal maintenance factor [Triticum aestivum]
Score 699
Evalue 2.88953e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10g23
AGGGTTTCAGATAGCAAACAGTACACCAATATCAGAATTCCCATAAAACAGACAAAAGCAGTCATTTTGCCAACTTACACTACATGTGGACATTTCTAGC
TCCATCACTAGCTCTTGAACAAAGAGGTAGCTGTTCATCACACAAGGGTCATCGGCTGAGGTCGATTGAGTTGTTATGCCGCAACTGGATGCCTGATGAT
CCCACGCCCTTCATCGAGGACAAAGCTGTTGTCACTGAAGTGAGAGCTGGAGAAGAACGGCCTCAGGTCGTAGATCTCATATTCTTGGGCCTTGTTCTTC
AGGTCATCCACTTTAACCTCAACGTGAGTCAGGCGTGTGGTTGATCCAGACACGATTTCTTCAAAGTGCAGCGCCTCCTTGACCAGGGTGCGCAGAAGGA
GCAGAAGCAGTTCATTGTAATCCTTCTTGTACGTCATGTACTTCCGGAAATTCTTCTGAAGTGCTTTCTGGACACCAAATTTCTGGGTTGAGATGAACGA
GTCAAGCAGCACACGAATGGCCATGTCCACATCTTCCTGAGACACATAGCTTCGCAGATGCATCTTTGCATGTGCCTCAGACATTCGAATGATTGATTCG
ATATGCCTTACTGCAATGGGGACTCCTTGACCGTGAGATGATTCACGTCGAAGTTCACATANACATGGCTGATCTTGTCAAGGTCAGCATCATGT
page-top