Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10h01
Contig Information
Length 705 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10h01   
Homology (BLAST) Top Hit Os06g0632700 [Oryza sativa (japonica cultivar-group)] >gi|113596168|dbj|BAF20042.1| Os06g0632700 [Oryza sativa (japonica cultivar-group)] >gi|215704898|dbj|BAG94926.1| unnamed protein product [Oryza sativa Japonica Group]
Score 672
Evalue 9.20056e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10h01
ATCACAATGTTTAATTTACCAAACAAATGTCGCTAGCCTAAGCAAAACAGTGAATAATACAGAGCAACTTGGAGCTAGAATCAACTACCATGCCGCAGGT
TCCCAAAGAAAGAAATAGCAGCATTTGCTTACAGGGAACATCAAGAGCAACTCTCCACCTTATTGTGTACATCGGAGAGCTCAGCTGGTGGCAAGGCGGG
CAAGGCTTCGCCGCTGATAGGAATTTTGCAAGTTGCTTTGTTGTGACCATAGCCTTTACATCTGCTGCAGCGCACTGCCCTTTTAATTGTGATGCGCGGA
TCAGCTGGCTTCTCTTTCGGCCTGCCAACACGTCGACGAGTTTGAATTGGGAATGGTAATGTCGCTAGACTCTGAGAATTGTCCGTTAAGGTAACATCAG
GTATCGGATTTATGGACATTGAATAGGTCGAGCGGTAGCTTTTCGTCGTGAAATACTCCACACAGAAGTCATACGCATACCTCCCAGTGCGCTCAAATAC
TGCAATTGCATGCACGCATGGCAACCCAGAAACATTCCACTTTCGGCAGGTGCAGTCATACGTCTCAATGTTGACAACATTAACTGAGTCATCGCATACC
TTGAATAAATTACCATCCCCATCACTTTCTGTGGGCATAACATTGAGTGAGTGAGCTTTGCTAACTTCTTCCTGCAATTTCTGGTTAGCTACAGGCGTTA
ATCCG
page-top