Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10k09
Contig Information
Length 632 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10k09   
Homology (BLAST) Top Hit Os10g0416500 [Oryza sativa (japonica cultivar-group)] >gi|9937559|gb|AAG02504.1|AF296279_1 class III chitinase [Oryza sativa subsp. japonica] >gi|20042965|gb|AAM08773.1|AC016780_3 Class III chitinase [Oryza sativa] >gi|31432082|gb|AAP53767.1| Glycosyl hydrolases family 18 protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639216|dbj|BAF26521.1| Os10g0416500 [Oryza sativa (japonica cultivar-group)] >gi|125531922|gb|EAY78487.1| hypothetical protein OsI_33579 [Oryza sativa Indica Group] >gi|125574797|gb|EAZ16081.1| hypothetical protein OsJ_030290 [Oryza sativa (japonica cultivar-group)] >gi|215678983|dbj|BAG96413.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215679360|dbj|BAG96500.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737517|dbj|BAG96647.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765415|dbj|BAG87112.1| unnamed protein product [Oryza sativa Japonica Group]
Score 651
Evalue 2.58709e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whdp10k09
GGCGAGCCAGCAGTCCAAGCCCACGCCGACCAACGGCGTTCTTCAAGCCGTTCTGGGACACGGGCAACCTCACGCCCGCCGCCATGGCCGCCGCCAAGGC
GGCCCACCCTAACCTGAGCATCATGGTCAGCCTCGGCGGCGACACCGTCCAGAACACCGGCGTCAACGCCACATACGCGCCGACCTCCGTCGACTCGTGG
GTGGCCAACGCCGTCTCCTCCCTCTCCGCCATGATCAACCAGTACGGGCTGGACGGCGTGGACGTGGACTACGAGCACTTCGGCACCGACGTCGACGCGT
TCGTGGAGGGCATCGGCCGCCTGCTCACCCAGCTCAAGGCCCGCTTCCCCAACATCCGCACCTCCGTCGCGCCCTACGACCTCCCAGTCAACCAGAAGTA
CTACCAGGCTCTGTGGAGGAAGTACTCCGGCGTCATCGATTATGTTAACTTCCAGTTCTACGGCTACGGCGCCAACACCATCGTCCAGTACTACGTGCAG
TTCTACGACNAGCAGGCGCGCAACTACCCCGGCTCCGGCGGNACCAAGTTGCTCGCCAGCTTCAANACCGGNAGGGCAAGCTGCCGGGGATCTTCATCTT
TTCNGNGGATANCTCTAANATGANCCCCTANA
page-top