Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10o16
Contig Information
Length 237 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10o16   
Homology (BLAST) Top Hit hypothetical protein OsI_21480 [Oryza sativa Indica Group]
Score 93
Evalue 0.0492145
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10o16
AATATCACCAAATNTGACCTTTTCACGCCCANGGAATTCCAGATGANTCTCGGACTTACCANCCTTGCGCTTCTTTTTCNTCTCATCAAGATGTTTCTTC
CTTTTCTGCTTCTTGGAAACCGAGACATTCGCCTCGAGCTCCTTGAAACGGAGATCCTCGACCTTCCCCCGCTTCCTCTTCTTCTTTCCACCGTCGGNGT
TCNCGTTCTCGTCGGCNGCCGGTGCACCCTCTGCTGC
page-top