Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10o15
Contig Information
Length 247 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10o15   
Homology (BLAST) Top Hit PREDICTED: similar to Homeobox protein GBX-1 (Gastrulation and brain-specific homeobox protein 1) [Nasonia vitripennis]
Score 83
Evalue 0.703411
Total Hit Count 43
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10o15
TCTACACAAAAAATAGCTGCGGGGATGGATCACAGCAACAGATCTGACTGACAAAACCATCCGCACTACCTAACAGATCACAGGAACAAAACAAAAACGA
GGGTGAAATACCGAATCCGACGAACAGAATCGGCGGCGGAAATGGGGACGGTTGGGTGCAGGATCGAGAGATGCCGCAGCCCCCACCGGCAGACACAGAA
GGGGGGCGGAGGAAGCGGGGCAGCACAAGGCAGGGCGCGGACGTGTC
page-top