Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp11c06
Contig Information
Length 488 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp11c06   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 522
Evalue 2.3123e-57
Total Hit Count 272
Registered year 2003
Contig Sequence     [ Download ]
>whdp11c06
GGCGACGCCTCGCGACCTCCTCAGCTCCTCACCCCCTTCGCCGCCGCTGCCACCGCGGGGACCCGCTCTGATCCCGTCAGTTGTAGAAGTAACTGATTAG
CCTGATGGCTATGGTCGATGAGCCTCTCTATCCAATTGCCGTGCTGATAGATGAGCTTAAATGAAGATATTCAATTGCGCCTGAACTCCATCAGAAGACT
TTCCACTATTGCACGGGCACTTGGAGAAGAAAGAACCAGGAAGGAACTGATTCCTTTCCTCAGCGAAAACAATGATGATGAAGATGAGGTGCTTCTTGCA
ATGGCTGAAGAATTGGGTGTGTTCATTCCTTATGTTGGGGGTGTAGAGCATGCTCATGTTTTGCTCCCACCATTGGAGACATTGTCTACGGTGGAGGAAA
CTTGTGTCCGAGACAAAGCANNTGAGTCGTTGTGCCGTATTGGTGCACAGATGAAAGAAAATGACATTGTTGACTATTTCATTGCAGT
page-top