Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp11c02
Contig Information
Length 676 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp11c02   
Homology (BLAST) Top Hit glutamic acid-rich protein, putative [Toxoplasma gondii ME49]
Score 75
Evalue 0.221925
Total Hit Count 36
Registered year 2003
Contig Sequence     [ Download ]
>whdp11c02
AGCACCCATGCCCTTCGGGTACCAGGAGCCAGGCGAGCGGCATCGTCCGTAGCCGTGACAATGATCCGCGCGCCGCCGCATCCAAGGACGGAGCCGTGCT
GCCTACAGGCAGCATGGGGACATCCAAGGGAAGGAAGACGACCCCGCTGGCGCATGCACCTGGTCCTGCTAGGTCATGCACACTGAGAAGCGCCGCGATG
TTGGTGACCCCGGGCGTCGCCATGGCAATAGCCCTCAGCATCACTCTGGAGATGCGCAGGGCCGACATGCACGCCAAGATGTTGGTGAAAATAGCGCGCG
GCCGCGGAACCGTGATGGAGCTCCTTCTAACATAGTTAGAAGTCCGAGCACCTCCGTTCCTCGCGTTTTTCGCTGCCACCCACGCGAGCAGAGGCGTTGG
CACGAGCACAGCTGCTCCTCGACTTTCCTCCTGCTGCGAAGAAGCAAGAAGAGTGGGGGTTTCTATCCATAGCCTTATTGGCCATGCCAATAATGATGGC
CACCANGAGGCAAGTCCTTCGCGACACCGGTCCATTGAGCCGGCGCACACCGGCAGTGGGANGATCGGAGGCGCTGCAACCACGGTGCACTCCCCTCCAC
CACNATGATANCGGTGGCCANCTCACTANGTCNATGCCCATGACNACNTATCCACANCATCATCTNATCCANNANC
page-top