Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20c09
Contig Information
Length 285 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20c09   
Homology (BLAST) Top Hit hypothetical protein OsI_33750 [Oryza sativa Indica Group]
Score 370
Evalue 3.67841e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20c09
ACTTCTCTCAAGTAGGCTCGCTGAAGATTTGCCCCTTGCAAGTTTGCACCTGACAACTTAGCCCCCTTGAGATTGGCCCCTTCAAGGTTAGCTCCATTCA
AATCGGCACCCGTAAGATTANCATTCTGTAAATGGGCTGAACGGACATCTGTCTCAATGAAGCTACATCCCGTTAAGCATGCATCTTGCAGGTTTGCGCT
TTGAACGTTTGCTCTGTCTANGACAGCTTCTTGAANATTTGCTCCANTAANCTCACNCTCATGTAAATTTGCCTGTTCAAATGAA
page-top