Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20c17
Contig Information
Length 178 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20c17   
Homology (BLAST) Top Hit hypothetical protein LOC100216775 [Zea mays] >gi|194696492|gb|ACF82330.1| unknown [Zea mays] (no hit)
Score 737
Evalue 2.42276e-76
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20c17
CTTCATACAGGTAAGTGGAAGTTTCAGTTCTGAAACTGATAGGACTGTGTTGTCCATACCCTAGCTAAGGAAGGTTCAAGTATAGAACTGCATGGTTCCA
ACTTCCCACGGTTTGTATTTTGCATGCTTTGAGCTCGGACTCCCCAAAAAGGANTGGGCTTTGCNTACTTCACACTCA
page-top