Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10j14
Contig Information
Length 670 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10j14   
Homology (BLAST) Top Hit hypothetical protein LOC100216775 [Zea mays] >gi|194696492|gb|ACF82330.1| unknown [Zea mays]
Score 737
Evalue 2.42276e-76
Total Hit Count 450
Registered year 2003
Contig Sequence     [ Download ]
>whdp10j14
GTCAGGCTGTCTGAATAAGCCTAGCAACATGGAGATAGTTCTATCTACTCGAGAGCAGATTGAATCTCGTAATCCACTANCATTTGCTCCTAAAGTGATT
CGCACATCTGAGCCTGGTCAGGAATTANGGGAATACCCTAACAAAACTCCTGCCTCGGCTCGTCACAAAAGGGGCTGCAACTGTAAGAAGTCATCGTGTC
TAAAAAAGTACTGTGAATGCTATCAGGGTGGCGTGGGATGCTCCATAAGTTGCAGATGCGAGGGATGCAAGAATGCTTTTGGTAGAAGGGAGGGACTCGG
ACCGTTAAGCATTGAGGAAGCTAAGCAGGGAAATGAGGAAAATAGTGCTTGTGTGAAGGAAGAAAAAAAGGAAGATGATAATAATCAGCTCGTTATCTGC
CCAGCTGCTAATCCAGCTCCTGCTGAGAATGTACTGACAACACCTTCAGCTATGGATGTCAGACCCTTGGCTTCTCGTCCACCTTCAAGCTCTAAGAGGC
CACGGTCTACGACAAAGGCCCTCGGACATCCTTCTCGACTATGCAACTCTCAAGCTCCTCTGAAGACGGACACTCTGCTCTCCCCATTTGAAAACTATGC
ANAAATTATGTTTGGGGTGGGTACATCANACAGCCTGAAAGGAGGGTTATCTCCTCAAACTTCTGTTAAG
page-top