Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10i17
Contig Information
Length 715 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10i17   
Homology (BLAST) Top Hit RecName: Full=Cysteine synthase; AltName: Full=O-acetylserine sulfhydrylase; AltName: Full=CSase A; AltName: Full=O-acetylserine (Thiol)-lyase; Short=OAS-TL A >gi|218335|dbj|BAA02438.1| O-acetylserine (thiol) lyase [Triticum aestivum]
Score 637
Evalue 1.08334e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10i17
ATGGACCACAGAAGGAGGAGTTCAATATACAGGGCAGGCAGGAGGTAATTCAAATTGCTAAACACCACAAGGCCAACACAAAAGTATTCCCCATTGCCAC
ACAAGGTGGGATTAAAACTTGACAGGACTTTGATGTCAGACCAACACTAGCAGGGACGCCGAAGATTTATTTCTTGTAGAAGAGGGCTCCTATGAATGGA
GGGATTCGGCTTCGGAGAACAGCTTCGCGCGCTTGAGGAGACGAGTCCCGAGCGTCACTCGACCACCATGCTCTCGGCCTCCTTCTTGATGGAGTGGAAG
AGCACCGACGAAAGGTAGCGCTCTCCGAAGCTCGGGAACACAACAACAAAGAGTTTCCCTGCATTTTCAGGCCTCTGAGCAACCTTGATTGCAGCAGCTG
CAGCAGCACCAGAAGAGATCCCAACCAGCAATCCTTCTTTCAATGCAAGAGACTTTGCCATCTCAATAGACTCATCACTTGAAACCTGTATGGTTTCATC
AATGATGTCAACATCCAAGACACCAGGGATAAAACCAGCTCCAATTCCTTGGATCTTGTGTGGTCCAGGCTTTCCACCATTTAAGACAGCACTCTCGGTA
GGCTCCACACCGTANAGCTTGATGTTAGAGTTTTGCTCTTTGAGGTACTTTCCAGTTCCAGTAATGGTACCACCTGTCCCGATGCCAGAAACAAGGCCAT
CGATCTTTCCACCTG
page-top