Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10n16
Contig Information
Length 710 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10n16   
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 605
Evalue 5.51138e-61
Total Hit Count 333
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10n16
GTGCCCCATCTGGCAACAATCAATCAATACCGATAGCACAAGTTCGCATTACCTCATACCTGGACCTACATGAACTATAGACCCATCGCCCATTCAGCAG
TAAACCAATAACTGTTTTGGGTATGCTGTAGCAGATAGGGGCAGCACAAAATACAAACTAGATTGATAGTTTGCAATCCTAGCCAGTGAAACAACCCCTG
CGCAAGTAGATTCCACCAAACGACATCATCTGCTTTGTGAAGGGTAGCGGGAACAATGCCGACATCCAAAGATAAATACTCTATTGATCGACATGAATCA
TGTTTGTACCACCAAATCATGATATCCAAGTCAGAATGCAGCCTCAAACGGTTCACTTGTTACGCTGAACGCATCCATTCTCGGTTAGGTACTCCACAAA
TTCATCAATTAGGTAGGGCCAAGCACCTTCTTCGTCATAGTTGGATAACTGTGGATCAATTGTCTTGACAAATTCCAACAGCTGAGACCATGTGTCCCTA
GAGATGGCTTTGTTATGCCTGACCTGTAGAAACTGACACCAGTGATCAATTAAGGGCCAATGCCTTTCAGCAAACAGCAACCTCCACATTCCAATAGCTG
TCTCCAGTGGAAGGGATTTCTGACCCTTTTCCCTAGCCCAAGCAAACGCAAAGTTGTATATCTCACGGAACTTATTATCGTCCTTTATCTCAGCTCGCAG
TGATGGAAGT
page-top