Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20c23
Contig Information
Length 622 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20c23   
Homology (BLAST) Top Hit hypothetical protein OsI_24555 [Oryza sativa Indica Group]
Score 580
Evalue 3.27443e-58
Total Hit Count 55
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20c23
CTGGGCGTACAAATGTATACAGAGCCCATTACACCACGGCATATTGCAACATATGACTTGTGTACTGCATATATGATATGTACTTCGTCATCAGTCGCGC
AGATTCTCACTGTGGTGGTACTGCATTTTGATCCAGTGTGTTGTAGGTGTAGTCGCTTGTGGAGTTCAATCCATACTTTTGCCTCATCGATGAGCTCCAT
AGGCCAGGGTGGGCACCTCTAGGGTCGGCCGTGGTAGGGAGATAGGCTGGAGCACCTTGGGCAAGAAGCAGCGGCCTCCTTATGACCACAAAATCTTCGT
CGCTGTCAAAGTCCGCATTGGTGGACGAAACCATGGCTCGTAGAGTAATTGCCAAGAAAAGCGAGAACGCCTGTGTGGCGACGGTAGCGAGAGCAGCCCA
TTTGCAGAGGTCGAGGTTGTTGTTGACAAAGGAGACGAGGTTCTCGAGCTCTCTCGTGCGGTCATACGGCAGATCCTGCATCCAGTGCTCGTTGAGGAGG
AGGTGGCCGGCCACGGCAGCTTCTANCAGCATCATCGCCATGGCCAGGATGGTATANAANCANAGGCAGCACCCGCTGTTGACCTCGGCGGCGACGTANC
CCGCNAGGAGGATGGCNCANTA
page-top