Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10i05
Contig Information
Length 681 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10i05   
Homology (BLAST) Top Hit coenzyme F420-non-reducing hydrogenase (methyl viologen-reducing hydrogenase), gamma subunit [uncultured methanogenic archaeon RC-I] >gi|110620625|emb|CAJ35903.1| coenzyme F420-non-reducing hydrogenase (methyl viologen-reducing hydrogenase), gamma subunit [uncultured methanogenic archaeon RC-I]
Score 84
Evalue 1.31153
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whdp10i05
TGCGGACCTGGTTCTAATTCAAACAAAAACCATATTTTATTACTACCTCCATTCAGAAATATAAGATGATTTTCGATATTATACTCCATATATGACTACA
TATACACNCAGAAATGAGTGAACAAAGACACTAGAACATGTCTTCAAAGGCATGAGAGCATAGGGATTACATGCAATATCCATAACNCAAGTTACCGAGG
CAAATATACCCTCTTAAAAGGTAGCATTGATGCTCATAAAGTACTCCCTCCGTCCCAAAATTCTTGTCTTAGATTTGTCTAGATACGGATGTATCAAGTC
ACATTTTAGTATTAGATACATCCGTATATAGAAAAATCTAAGACAAGAAATTTGGGACAAAGGGAGTAGTTGAAAGTAATCTATAAGAAATCAGTGTCAA
CCTCTCACATGTTTTGGTCAAAAGAGGAATTTAGAACCGTCATTTGGCACACTAAAATCACATGCAAGATCACCCAGAAAGTTGTACTACCAGTACTAGT
ACTGCGTGTTAGATGAAAAAACACGATCAAGATCGAGAAAAAGATCGTCAACAAGAGACATTACCTGGACTTGCTTAATGAGGGATCCCGGAGAGGGGGG
CTTGGACAGGGCGATGGCTTTGAGCTTGTCTGCGGTAGTCTCGGCAGGGTGCTTGCGCTTCTTCGTACCATGAGCCTCGAC
page-top