Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10i03
Contig Information
Length 158 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10i03   
Homology (BLAST) Top Hit hypothetical protein HD1941 [Haemophilus ducreyi 35000HP] >gi|33149144|gb|AAP96661.1| conserved hypothetical protein [Haemophilus ducreyi 35000HP]
Score 75
Evalue 6.07706
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whdp10i03
TGTGTGATTGGCTTTCGCCGTGTACTCGTACCAGCATCGATCATGTATCAGTTGTGTGGTTAGTTTGCGCCATACCCGCTCGAAAATCTTTGCTGAAACT
TCTTCGCCTGGCGATGATGCCTACATTGAATAATAATGATCCAGTGTCAAAAAAAAAA
page-top