Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp11b11
Contig Information
Length 448 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp11b11   
Homology (BLAST) Top Hit Sec61 alpha 1 subunit [Acyrthosiphon pisum] >gi|52630957|gb|AAU84942.1| probable transport protein Sec61 alpha subunit [Toxoptera citricida] >gi|89574501|gb|ABD76381.1| putative transport protein Sec61 alpha subunit [Acyrthosiphon pisum]
Score 670
Evalue 6.16632e-69
Total Hit Count 348
Registered year 2003
Contig Sequence     [ Download ]
>whdp11b11
ANATTCCAATCATNCTGCAATCTGCTCTTGTATCAGATCTATACNTCATATCTCAGATGCTATCCGTCAAGTTTGCTGGTAATATTCTCGTGAATCTCCT
CGGCGTTTGGCCAGATGCTGCCAGCGGTGGTCCATCCCGTTCCTATCCTACGGGTGGTCTCTGTTATTACCTATCGCCTCCTGAGACACTGTCCCATATT
CTTGAAGATCCATTCCACGCAATTCTCTACATTATCTTCATGCTCGGCTCATGTGCATTCTTCTCAAAGACGTGGATTGAAGTGTCAGGATCGAGCGCCA
AGGATGTTGCCAAACAATTGCGCGAGCAACAGATGATCATGCGTGGCCACCGTGAAACATCCATGATACACGAATTGAACCGATACATTCCAACGGCTGC
CGCTTTTGGTGGTCTGTGTATTGGTGCTCTCANTGTCATGGCCGATTT
page-top