Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20d11
Contig Information
Length 699 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20d11   
Homology (BLAST) Top Hit hypothetical protein OsI_20689 [Oryza sativa Indica Group]
Score 294
Evalue 6.12214e-25
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20d11
AGCACAACATCATGGTAAAAATTCAAGCACAAATGTGCATGCCACATATGGCTAATTTAGCAATGATTTTCTACCTTTTCTGCCTGAGCAAACATAATTG
CTAGTGACAAATTACAAATGCCATCATTAACATGTATTAGTAATCGAGAATGTGCCACAACTGGTAACATTCTTTTCAAGGAGCACGAGCCAAATCTCGC
GCTATCTTACAAGCTTCTGATGTGCTAGTGGCACTCATGTCACACTGCAAGAACGCTGCAATAAGGGAGATAGCAGCCACGGACTCGACCGTGTAAATCG
CGTTGCTTGCAGCAGTATGAATGTACGATCGATGGCAGCTGGTTCCTCCTACGCACCGTGGCTACATCAAAATTCATTCTCATCTCATTTCTCCATGGAT
CTACCTGCCAAAAATGAGCCCTTAATCATATCGAGTCCAGCTTGTTCTGCTTGAGGAACTCGAGGTCCTTGAGCTGCCGCTGCGCCACCTCCTTGGGCAC
CACCTTGGCGCCGGGGCCCCTCCTCTCGCCGGAGGCCACCTGCTTGGCCACGGTGGACACCATCCTCTCCACCGCCGGCCTCCCCACCGACGGGAACACC
GCGTTCAGCATCGTGCACAGCANCCGCTCGTCCTCCGGCTCCACCATGTCCTGCCCNNAANCANCACACGTANATGGCCTCCANCGCCTTCTCCGCCTC
page-top