Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp8m24
Contig Information
Length 753 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp8m24   
Homology (BLAST) Top Hit hypothetical protein OsI_28203 [Oryza sativa Indica Group]
Score 574
Evalue 2.44474e-57
Total Hit Count 70
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp8m24
TATCAGAATAATATGAGATATCCATATAGGTATTGTATTACAAGTTTACAACGGGCATCACTCCTACCATAAAAACAGTAATTTAATCTAGTTTTTTTCC
AGTAGAAATGAGTAACACAGACAGAAAGGGCCTTCTAGTTATAAAGGAAATATTGTGTACTAACACTGGCACTGCCTATTGTATGGTTCTGTTGCAAAGG
GCCTATTAAGCAAAATTAAAGGACAAACCTATCGACCTAAAGCTAAGAATGGCACTCTTCATGCACTGGGCACTCAAGATGAAATAAGCTTCTGTTTCTC
CTCATCATACTCAGCACTGTCACTTTCATCCTTAAGTTCCTCCGATGCCGTTTCATGCTGAGCTGATGCAATATTTCCTTTTGCAGTAACTGATTGCTGA
TAGAGTACTCCACCAGCAAGAGTGAACAGCAGGCTAACCAAACCAAATGCACTGGCGTGCTTGTCCCAGATCGTCACATTGATTGCCACCGTGAGGAACT
TGTTCACAACCCCAGTCACCGTGAATGCCGTGGCTGAGATTGCTTTCCTAGCCGCAAAGCCAAAGAAGCTGATGAGTAACCCAAACAAGCATGACAATGC
CACCGCGACAAAGGCATCGAGCTGGAACCAACCCTCAACCCGTGATTCGACTGCTGAGAAGACCGACTTGTGCTCCCCTGTCAAAAACCAAAAGATGGGG
GATATCATCAAGGAAAAGAAGGTTGTTATACAGCACAAAACCCCATGTGNTTA
page-top