Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20e12
Contig Information
Length 112 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20e12   
Homology (BLAST) Top Hit hypothetical protein OsI_23801 [Oryza sativa Indica Group] (no hit)
Score 861
Evalue 7.47741e-91
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20e12
TCTGGTCGGGGTCANACATGATGGTGCACGCCACTTTATTCCTCATCGCTACAAANACTGGTGCATCAGCTAAGACAACGATGATCCATCTACACTATTA
GCATAANTCTTC
page-top