Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10h01
Contig Information
Length 589 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10h01   
Homology (BLAST) Top Hit hypothetical protein OsI_23801 [Oryza sativa Indica Group]
Score 861
Evalue 7.47741e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whdp10h01
GGGTGCAGACCACTCCTTTTCCTTGATGCAGTATCTGCAAAACCGAATAAACAATGGAAGTTACTGACTGCTACTTCAGTTGATGGGGAAGGCGATGTGT
TCCCAGTTGCATTCACTGTAGTGGACAAGGAGAGCCGTGAAAATTGGCATTGGTTTCTTGAGCAACTAAAATATTCACTGTCGGCATCTCATGACATAAC
ATTCATATCTAATGGAGAAAATGGATTATGGGATGAAGTATCATTGGTTTTCCCTGACAGTCATCATGGATATTGCATGGACTTTCTTATTGAAGCATTT
AAGAGGCAATTGGATGATGCGTGGACTGAAGAAGTAAGAGATGCTATGGTTGAGCTTCTTAAGAGGGCCATATTTTCATGCACAATTGATGAGTTCAATC
AGTATATGGAGCAAATTAAAAGTGAATCTGATAAGCTTGCTGAATGGCTTTTGGAGATCAAACCTGAGCGGTGGTCAGATGCCCTTTTCATGGGGTCGTG
GTATGGTCAGTATTCATGTAATATTTCCAACACTGTTGTTGACTGGATCCCCACAANATATGAGCTTCCAGTTGTGCANNTGGTTGACA
page-top