Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10g23
Contig Information
Length 633 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10g23   
Homology (BLAST) Top Hit minichromosomal maintenance factor [Triticum aestivum]
Score 1050
Evalue 1.07625e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whdp10g23
TGGAGGCAAACTATGTATCAAAGAAGCAGGATCTGTTCTCTGCATACAAATTAACAGATGAGGACAAGGCTGAGATTGAGAAGTTGTCGAAGGATCCTCG
TATCAGTGAAAGGATTGTCAAATCAATTGCACCATCCATTTATGGTCATGAAGATATCAAGACTGCCATTGCACTAGCTATGTTTGGCGGGCAAGAAAAG
AACGTGAAGGGAAAGCATCGCCTAAGAGGTGATATTAACTGTCTCCTCTTGGGTGACCCAGGCACTGCGAAATCCCAATTTCTCAAGTATGTTGAGAAAA
CAGGACACAGGGCTGTATACACAACTGGGAAAGGAGCTTCTGCTGTTGGACTCACAGCAGCAGTTCACAAGGATCCAGTAACACGGGAGTGGACCCTTGA
GGGAGGTGCACTGGTTCTTGCTGATAGAGGCATATGCCTTATTGATGAATTTGATAAGATGAATGATCAAGATAGGGTAAGTATTCATGAAGCCATGGAG
CAACAAAGTATCANCATATCAAAGGCAGGGATTGTCACATCCCTTCAAGCTCGATGCAGTGTTATTGCTGCAGCAAACCCAGTTGGAGGAAGATATGATT
CTTCGAAGACATTCACTCAAAATGTTGAACTAA
page-top