Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10k16
Contig Information
Length 412 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10k16   
Homology (BLAST) Top Hit ubiquitin-associated protein [Triticum aestivum]
Score 271
Evalue 1.12413e-22
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10k16
AGGTCTTCCAGGTCACGATAGTAGGAACAAAGCAACTAAGGCCATTACAGCAACCACACGCAGCTGACCCACGACGGTCACAACATAAGAGTTCACACCG
CACACACAGTCACACCAACAACACGCTTCACAGCAGTTCATAAGCAAACCACGAGACATACTGGAGCAGCAGAACAGCAGTACCACTCGTCTCATTATTT
ACGCATATATAACGAGATATAGATAACTAGGTGCTCGAGAGCACACGATCTTCACTTGTCCTTCTTCTCCCTGGCGATGAGGTCCATCACAGCTCGTTTG
ATGCTTCCTCCATTCTTGGCAAGCAGCTCCTTGTTCGTCTCCCTGTCATCAAATCCCATTTCGTTCAGTTCCGCCAGCAGAGGGTCCCATTCATTGACAC
CACACAGATCAT
page-top