Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10k20
Contig Information
Length 638 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10k20   
Homology (BLAST) Top Hit hypothetical protein OsI_18766 [Oryza sativa Indica Group]
Score 256
Evalue 1.29439e-20
Total Hit Count 36
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10k20
TGTAGAGAGAATCGAATACTCGACAAAGTGAGTTCTTATTACATTGGTTGCATAATACAGTCGTTGGATGATAATACTGGAGAAAATGAACTCCATCTAC
AATCATCACAGGCTGATGCTGCACCAAATCAGAAGTCGAGCAAGTCTGAAAAATCGAAGGCTTTGAGTGCCTCCTTGCGTGCTGCTTCGTTCATTGCTTC
CATCTCCTGTTGATGGCGCAGGTACTCATCATCCACCTCGACGTAGCCATTCTTGGCGTACTCGGTGCGGACCCAGGCCTGGAATTCCCTGAAATCCTCT
CCAATCTCGTAGAAAAAGCGCACGACGTTGTAGAAGCTCACCACGTCCTCGTCCATCTCCTCTTCCGGCGAAGGAATCAGGGCAGGGTTGTGGCGCTTCA
GGGCCTTGTACTCGGGAGGGAGAGAGTCGTCATCCATCTCCTTGGTTAGGATGGAATCCACCTCCTCCTGCGGCAGCCTCGTCATCTTTCTCTCCGGAGC
CTCCTCGCGCCTGGCTGCCGCCGCCGTCGCCGGTGTGGCTCCCTGCCCCAACTCANANCANNCNATCCCGGNTGNTTTCCTTCTGATGGANNANANCTCC
NNNGNANATNCNNNNNCTNNNGNNGNCTCNNCNGNTTT
page-top