Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10n07
Contig Information
Length 101 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10n07   
Homology (BLAST) Top Hit palmitoyltransferase ZDHHC9 [Zea mays]
Score 136
Evalue 5.0055e-07
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10n07
CNCTGGTTGTGCCGTGGCCACTGCTGACCGAGCCCCAGTTAGTTTCTCCACCTCCCATCTGCACGGCAATGCTGTCCATCGACTCTGAGGTCCCACTTCT
G
page-top