Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20e20
Contig Information
Length 140 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20e20   
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_133365 [Branchiostoma floridae] >gi|210080873|gb|EEA30034.1| hypothetical protein BRAFLDRAFT_133365 [Branchiostoma floridae]
Score 75
Evalue 5.94364
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20e20
GGGGATGCAGGTCTTCCACCGCATGATTGAAGACATCGACACTTGGACGATAGCCGGCCGTAACAAGATCAACAACCTGCTGTATAGACCTCTAGAACCA
GACTAGACATTAGGATACGGTATGCGGTGATGCACATTTC
page-top