Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20f17
Contig Information
Length 681 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20f17   
Homology (BLAST) Top Hit cell wall beta-glucosidase [Secale cereale]
Score 268
Evalue 6.11305e-22
Total Hit Count 345
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20f17
ACTGTCTTGGGAGAAAGATGCTAAAAACGGTAACCAACTCAGACCAACTAAGTATATCTCTTTGTCTAGGACCTATCCTCTCCCCTCTTTATTTCTCTCC
CATCTCCCCTCTCCACTCTCAGTATAAACGGTATGTTCAGAAGGACCGCAGGTACTCCGACGCCATGGCCTGGAGCTCCAACGCCATCGCCTGGAGCTTC
TCAAGGTCGGCGGTGAGGTCCAGGTTGGGGGAGAGCATGAAGCCGGCCCCGGCCGCGAGCGCGATCACCAGCAGGCTGCCCTTCAGGCAGGTTGCGCCGC
GCGACAGCCTCCCGATGATGGCCTTGCAGTACTTGTCGGCCTCCTTGATGGACGCCTTCTCCCCAGAGTCCTCTGCTTCCTCCAGAGTTTTTTTTCCGCA
AGAACGCATCGCTCTTTTATTGCTAACAACAAATCAACCAGAAAACTCAATGTATGTATGTATCCCATCTCTCACAGCCCAGCCGAGATAGTACATCCAC
ATCCCATCTCACCCGACCCGACTCACTTGTTGGCCTCGGTGGTGAGGCCGAACCCGAAGGGAAACAGCGGGTCGTAGTGCTTGTCGCCGACGTTCATCGG
CAGCTGGTCCACCGACTTGAACCACGTCCTGGNCAGCTTTCCGGAGAANCCATAGTCGCCGAANAGCGCGTCACGACGCCC
page-top