Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20g06
Contig Information
Length 764 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20g06   
Homology (BLAST) Top Hit Os10g0549700 [Oryza sativa (japonica cultivar-group)] >gi|113639844|dbj|BAF27149.1| Os10g0549700 [Oryza sativa (japonica cultivar-group)]
Score 311
Evalue 7.8639e-27
Total Hit Count 70
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20g06
AACTTATTGCACCGATTCAGGCATAATTTCAGTTAATATTAAAGATACATATGCTTCGGTTCCTTCCCTTACACACCCTGCATGTCACATGCATCACCTC
TTGCCACACTCTAAAAAGAACTTCTCGCCATACACCTGAACCATATAGTAGACAAAAACCAAACGGGAAATGCATGGGAGCTCTCAGGTGCCACAAATCC
ACATCCAAGACCAAACAGATCAGTTTGTGGTTCTGTGTTGGATATATAGATTCCTTTCACATAAAACAGTCATCATCACTGTCCAGCTCCTCAAAGTGAA
AAATCATCTCATCATGTCCACCCAAGTAGCCACCGCCCGAGGGATGCCTAAGCTCCTTTGCTCGATCGTCACACTCGACACAATGACCATAGTCGTTTTC
TTCCAAAGGAGTGCAGCAGACAACATCCTCTTCCTGTGTGCAGTCAGGATGCATCTCAGCAAAGAACATAGTAGGTTTGCCATCTGAACCTTTCACCAGA
AAGTTGGAGTGCACATATAGTGCTCCGCATCCATAGACTTGGTTCCTCTCTTTCTCTTCCACAAATTCTAAATCAGTGAGCTGCATGTTGTTTCGCTTGG
CATATGTGTTGAGCGCTATGACCAAGCCCTTGCGCTTACGCTCCTGTCTGCGTTTCGTCAGCTCCTCAGGCGACGGCGACTTGGGCCTGAGGCTGAGCTG
GCGCTCGGCGGCAGCAAGCCAAACATCACTGAACTCCTGGAGAGTATTTGATGATGGGCTANAA
page-top