Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20g20
Contig Information
Length 109 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20g20   
Homology (BLAST) Top Hit hypothetical protein OsI_12062 [Oryza sativa Indica Group] (no hit)
Score 91
Evalue 0.083704
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20g20
TATTGTGTACACACTACAAACCATATCTACTAGTATGATCCATGGACCTAGCTAGTCGTTCGACACACACACACACACACACACACACACACACACACAC
ACACACNTG
page-top