Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10f21
Contig Information
Length 431 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10f21   
Homology (BLAST) Top Hit unknown [Aegilops tauschii]
Score 236
Evalue 1.29029e-18
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>whdp10f21
CGCCTTCTTCAGGTCAGCCGCCTTTGCCTGATTCTCCTTCTCGAGAAGCTCATAACGGCCGGCGGCGTCCCTCAACTCCACAACCATCTCGGCTATCTTT
TCTCCGCTTCGGTGGTGAGCAGCCTGTGCGGCTCTCAAGTCTTCGGCTGCCTTTGGGGCAGCCACATTGCTAACCCGGGCTTGCTCCTTGGCTAGGGCAA
GTTCCACCCTCAGGGCCTTAATGGCAGTAGCTCCGCCTGCAGCCACATCATATCATGTTAATATTACGATCCTTCTTCATATTTCCTAAAACAAATGAGA
AAAAACGAGCGCATACTCTGTGACTCGTCAAGCCGCTTATTCACAAGCGCGATGTCAGTATCCACCACATCAATCTGTCGCCTCANTTTGGCGAATTCAN
AATTCCGGTCTATCGCCGGACTCTTANCCAC
page-top