Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20h20
Contig Information
Length 270 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20h20   
Homology (BLAST) Top Hit Os01g0750000 [Oryza sativa (japonica cultivar-group)] >gi|14209558|dbj|BAB56054.1| GTP-binding protein GTP1 [Oryza sativa Japonica Group] >gi|32966065|gb|AAP92129.1| GTP-binding protein GTP1 [Oryza sativa (japonica cultivar-group)] >gi|113533781|dbj|BAF06164.1| Os01g0750000 [Oryza sativa (japonica cultivar-group)] >gi|125527712|gb|EAY75826.1| hypothetical protein OsI_03740 [Oryza sativa Indica Group] >gi|125572029|gb|EAZ13544.1| hypothetical protein OsJ_003369 [Oryza sativa (japonica cultivar-group)] >gi|215765620|dbj|BAG87317.1| unnamed protein product [Oryza sativa Japonica Group]
Score 442
Evalue 1.67085e-42
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20h20
ATCTCTCAGCTCTTTTAGCCAGCGCGCCACATTGTCGAATGTAGCACGGCGAGTGACATCATACACAAGCAACGCGCCTACTGCTCCTCTATAATAGGCA
CTTGTGATAGCACGGTATCTCTCCTGGCCGGCGGTGTCCCAAATCTGGGCCTTGACGACCTTGCCGTCGACCTGGAGGCTGCGGGTGGCGAACTCGACCC
CGATGGTGGACTTGGATTCNAGGCANAACTCGTTCTTGGNGAANCGCGANAGCAGGTTGGACTTGCCGAC
page-top