Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20i14
Contig Information
Length 552 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20i14   
Homology (BLAST) Top Hit hypothetical protein OsI_37900 [Oryza sativa Indica Group]
Score 716
Evalue 4.02851e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20i14
CACTCGGCAGTTTTCAATGAGAAAACAATTTATTCGAGACGCAAAGACGGCCTTTAGATGCCCTTCTCCAGCATCGCGCGGACCCGGGTGGGGAGGCCGT
ACAGCCTGATGAAACCTTCGGCGTCAGCCTGGTCGTAGATCTCCCCGTTCTCGAACGACGAGATGTCCTCCCTGTAAAGGCTGTAGGGGCTCTTCCGGGA
CGCGACCGTCACCGACCCCTTGTACAGCTTCAGGGTCACCGAGCCGGTCGTTGTCGCGGTGATGGTCTCCATGAAGGCGTCCATGGACAGCCGGAGCGGG
TCGAACCAGCGCCCCGCGTAGACGAGCTCCGCGTACTTGAGGGCCAGCATGTCCTTCCACTGCATCGTCTCCCTGTCCAGTGTCAGGGACTCGAGCTCGC
GGACCGCGGCCGCCATGATGGTGCCGCCGGGGGTCTCGTANACGCCGCGGGACTTCATCCCCACCANGCGGTTCTCCACCATGTCNATGCNCCCNATGCN
NNGCTTTCCNCCNATTTCNNTNANNTTNNNNANGANANNNNNTNNNNANANA
page-top