Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10f13
Contig Information
Length 651 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10f13   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195623302|gb|ACG33481.1| vacuolar ATP synthase 16 kDa proteolipid subunit [Zea mays] >gi|195638000|gb|ACG38468.1| vacuolar ATP synthase 16 kDa proteolipid subunit [Zea mays] (no hit)
Score 420
Evalue 1.23003e-39
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whdp10f13
CAAAAGGGTGGTCATGGCAGAGAAATGAACACCATTGCTGAAATGTCTGATCCAGAAAGTTATAAAACTCCGCCTGGTGAAACAGCAACTGAACGCAACA
ACATGCTTCAAAGGATTCGCCGCCACCGGGCGAAGAAATGGTACAATTATGAAAATGTTCGCAAAAAGTATTAGATTTTGTTTGCTTTCAGTCCACCTTG
GAATGATTGCATTGCTGAAAACTGCTTCGGCCCAGATGATGAAAAAGTTAGACCACCTCAGCCTCAAAATGGTCATCCTGGCTTCTTGAAAACGACCGCT
GATTTTCCCGAGGAAGTGGCTAAGAGGGCGAAGGCCAAAGCCAAGCGTGAAGCTAGGGAAGCAAAGAAAAACAAAGTTGAAGCTCAAAATGTTGCACTAA
CTTAGCAAGACGCCAGGAAGAAGAAGGATTGTGCCTCTGCCCGAAAGGAAACCAAGGCCGGGAAATCTGTTTCCCCTCATGCTCCCCGAAAGAAAACGAC
CATCAATAAATCCAAGAAAGTTGTTTCTGACTCGTCTAATGGGTCATCCAGCAAAGGTGCTGCTGATGAAATTCCTATGTATGATCAACGTGCCATTCTC
AACAAGCCGTCTTTGAGCCCCTCACCAGTGAAAGTTTTGCCCTCTCCAAGG
page-top