Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp8n07
Contig Information
Length 635 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp8n07   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195623302|gb|ACG33481.1| vacuolar ATP synthase 16 kDa proteolipid subunit [Zea mays] >gi|195638000|gb|ACG38468.1| vacuolar ATP synthase 16 kDa proteolipid subunit [Zea mays]
Score 420
Evalue 1.23003e-39
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp8n07
CTCGCCGATTATTACTCCNACNATAAATACGACAGGTGCTAGGTACNACNAGTANATACAGGTAGCTTTGCGTTGCCGAACATAGAATAAAATTACAGAT
GGCGGGCGTGGAAATCCCTATGATCCCANACCACATTATGTTCCTCCGCCNAGGANCATGAACACAGAAGTAGAACCACAGTGTTTGCCAAACAAGTCTC
TAATGAAGAAATGAACCCTTTCAAACAGAATACAATGATGGACCGTATGCTCCTTGCTTGCAAGCGCTTTGTTTCTAGTCGGCGCGGGATTGGCCGGCAC
GCGAGGAGAGGATGATGCCGACGATGAGGCCGTACAGGGCAANAGCTTCGGCAAAGATGAGGATGAGGATCATGCCGACGAACAGCTTGGGCTGCTGTGC
GTTGGCCCTGACGCCGGCGTCGCCGACGATGCCGATGGCCATGCCGGCGGCGAGCCCCGCGAGGCCGCAGGCGAGGCCGGAGGAGAGGTGCGCGTAGCCG
TCGAAGAGGAAGTAGGGCTTGGCCTTGGGGTTGATCCCGGTGGAGATGATGACGGCGATGATGAGACCGTANATCCCGAGCACCCCGGCCATGACGACGG
GCACGATGGACTTCATCACCANCTCCGGCCGCATC
page-top