Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp11a15
Contig Information
Length 644 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp11a15   
Homology (BLAST) Top Hit A 'c' was inserted after nt 369 (=nt 10459 in genomic sequence (M10126)) to correct -1 frameshift probably due to gel compression
Score 77
Evalue 7.56211
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whdp11a15
ATGCCACGAAACTTTTTGGAGATTTTTTTCTGGTGATATAAGACCCTGGAAGCTTATGGAGCACATGAGAGGAGGCTCATGGGGCGCACCAGGGGCCTCT
AGCGCCCCCTAGTGGGTAGTGGGGCCCACAGGCACCTTCTTTACCTACCTCTGCCTCTATAAAAACTTTAAAATCCCCAAAACCCTAGAGGAATCGACGA
AATACTCTTTCCGCCGCCGCAAGTTCCAGAACCACAAGATCCAATCTAGAGTCCTTTTCCGGCACTCTACCGGAGGGGGCAACGATCACGGAGGGGCTCT
TCATCATCCTTGTTGCCCCTTCGATTATGCGTGAGTAGTTTACCATAGACCTATGGGTCCGTAGTTAGTAGCTAGATGGCTTCTTCTCTCTTTTTGATCT
TCAATACAATGTTCTCCTTGATGTTCTTGGAGATCTATTTGATGTAACTCTTTTTGCGGTGTGTTTGCTGTGATCCGATGAATTGTGAGTTTATGATCAG
ATCTATCCATGAATATTATTTGAGTTTTCTCTGAACTCTTTTATGCATGATTTTATAGCCTCGTATTTCTTCTCTGATTTATTGGTTTGGTTTTGCCAAC
TANATTGATTTATCTTGCCATGGGAANANCTGCTTTGNAATTGG
page-top