Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20j18
Contig Information
Length 735 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20j18   
Homology (BLAST) Top Hit epocide hydrolase domain-containing protein [Frankia sp. EAN1pec] >gi|158113780|gb|ABW15977.1| Epoxide hydrolase domain protein [Frankia sp. EAN1pec]
Score 80
Evalue 4.47073
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20j18
GCGGCAGGAGTTTCCACCCAATTATACAGTTCCCGTAAATAACAAATCCAACTCCACAACTGCCCCAAAATAAAACCACCCTGAAACCAATGACACTTCT
TGTTCAACCAGTCACACAGCCTCACTGAAAACTGAAATGGAGCAGCAGCAAGGATAGCAAAAAAAGGGCTCAACCCACAACACCTGGAAATAAACCGACG
CATGCATGCAGGGTCTTGCACAACGGCAAGCCGTCGAAGTTTTGACCACGAGGAACCCTTACAAAACAGTCCGATAATGGATGCAGGACAATGCAACTAT
GAAAAAGGAAACATGAAATAAACAAGCTACATACTCTCGAAAAAGAAATTAACAAGCTACCAGCTCGTGAGGGACATGTCCAACTTGGACCTCCTGAGCA
GTGCAAAATTATCCCGTGACAGTGCACGCGAGCCCCTTATGCATAACGGATCCATAAGCAACCGGGACTTGTAACCATACGACCAAAGTTCGATGCATGC
AATGGATGCAAGGGAAAGCGATGGCACGCCCAGACCATAGGGCATGCAAGCCACGCCAACAAACCATCGGCATGGCACCCAACCATAGAAGCTCATCTCA
CCCCCAATAAGAAATTGAAGGTTCTAGATGCCTTTAGCAAAGTTAGCAGGCAGCCAACTTAACCCTCTTTTCCACACAAGTGAAAAAGGCTGGGCTGACA
CATGTACTGATGCATGAGTTAGTGAGGACCCTTCG
page-top