Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10f06
Contig Information
Length 338 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10f06   
Homology (BLAST) Top Hit cysteine protease [Triticum aestivum]
Score 367
Evalue 8.24189e-34
Total Hit Count 318
Registered year 2003
Contig Sequence     [ Download ]
>whdp10f06
ATCGCCTCGTGGCCCCTCTCCTCGTCCTCCTGGGCCTCCTCCTCTCCCCGGCGCCGGCAGCGCCGGCCGCGGGGGACGAGGAGCCCCTGATCCGGCAGGT
CGTCGGGGCCGCCGACCCCCTCGACAACGACCTGGAGCTCGACTCGCAGTTCCTCGGCTTCGTGCAGCGGTTCGGGAAGACCTACAGGGACGCGGAGGAG
CACGCGCACCGGCTCTCCGTCTTCAAGGCCAANCTCCGCCGCGCGCGCCGGCACCANATGCTCGACCCGTCCGCCGAGNACGGGGTCACCAAGTTCTCCG
ACCTCACCCCGGCCGANTTCCNCCGGACCTTCCTGNGG
page-top