Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10f05
Contig Information
Length 368 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10f05   
Homology (BLAST) Top Hit H0211A12.6 [Oryza sativa (indica cultivar-group)]
Score 103
Evalue 0.00336427
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>whdp10f05
GGGGAGCAGCCTCCAAGACCCGCGACCACGACAGGGGCGGCGGCGGAGCGTAACCAGATCGTGGCAAGGCCGAGAGAAAGAAAGCCGCAGGGTCGGGTCC
AAAGGATGATGACCAGCCTGCTCGGGCCGAAGCCGCCGACGTATGAACAGAACGGCTACAGATGAACTATGATTGTACTCTGGAGCAAGATGCTCGCAGC
TCGATTCATTCCATTGGTGACATAGTGTGACGTGATTGGTGTGGGATTTGTGTACTTGTGGTGTGTGGATCTTTATTGCATCGGTTGTTGTTTGGAAACA
TGTAACAAAGATCAAAACTGCCCATGGCAACAACTGATAATAATACAACAATTGAANATTTGTTCCAA
page-top