Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20k03
Contig Information
Length 498 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20k03   
Homology (BLAST) Top Hit H0913C04.12 [Oryza sativa (indica cultivar-group)] >gi|90399169|emb|CAH68351.1| H0723C07.1 [Oryza sativa (indica cultivar-group)] >gi|125550294|gb|EAY96116.1| hypothetical protein OsI_17994 [Oryza sativa Indica Group]
Score 379
Evalue 3.57339e-35
Total Hit Count 74
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20k03
ATTTGGAGACATGCATATGAATATGGATGGGTGGAGGTCCAAGAACCGATGATGATGCATGAATTGATCAGACGTCGACGGCGCATGCGGCGGCCTGCTG
GAAGCGGAAGTAGTCGGGGCCGCCGCCGGTGGTGGCGCCGTAGCTGCCCTTGCCCTCGTTCACCCTGATGAGGGCCGGGCAGTTGACCCGGAGGTGGTAG
TGGCCGGAGATCCAGGTGCCCACCTTCCAGCGCACAAAGCCGTCCACCTTGACGTCCACCAGCACGTACCCGGCCGTCTCGTCCTGCGCCAGCGCCACGG
CGAGCACCGGCGGGAGCACCACGCTGTCCATGGACCTCANATACGGCGACCACACGGACTGGTCCCGGTGGCCCTGGTANGCNACNGNNANGCNGNTGNN
CACNNTGATGGCCACNCCCTTGTACTGCNCNTACATGTCCNNNCNTANTTACTCCCNNCNNTTANCCNNNCTTNNNTNAATTTCTTNNNTTTNNNNTT
page-top