Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10f02
Contig Information
Length 470 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10f02   
Homology (BLAST) Top Hit truncated high molecular weight glutenin subunit 1By9 [Triticum aestivum subsp. yunnanense]
Score 241
Evalue 3.41796e-19
Total Hit Count 231
Registered year 2003
Contig Sequence     [ Download ]
>whdp10f02
TGGTTGTTGCCCTTGGTTCTAGTTGTTGCCCTTGTCTTGTTTGTTGCCCTTGTCCTGGTTGTTGCCTTTGTCCTAGCTGTCCTATTTGTTGTCCTTGTCC
TACCTGCTGCAGAGAAGCTGGGTAATGCCCTTGTTGCCCTTGTCCTGGTTGCTGCAGAGAAGCTGTGTAATGCCCTTGTTGCCCTTGTCCTGGTTGCTGC
AGAGAAGCTGGGTAGNGCCGTTGTTGCCCTTGNCCTGGCTGCTGCTGAGAANCTANGTANTGCCCTTGTTGCCCTTGTCCTGGCTGNNGTTGAGAANCTG
GGNACTGCCCTTGTTGCCCTTGANGCTGGCTGCTGCTGACAACCTGGGTACTGCCCTTGTTGNNCCTTGTCCTGAGNTGCTGCTNACNAAGCTGNATACT
GCCCTTGAATGCCCTTGTCCTGANTGNTGCTCGAGAANNTGGANTACTGCGCCTTGNTGNCCTTGNCCNG
page-top