Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp11a14
Contig Information
Length 599 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp11a14   
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 265
Evalue 1.00612e-21
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>whdp11a14
AGGTCTCTGGTTCAAGTCCAGGATGGCCCACACTGCGCCAGGGAAAAGAATAGAAGAAGCATCTGACTCTTTCATGCATACTCCACTTGGCTCGGGGGGG
ATATANCTCAGTTGGTAGAGCTCCGCTCTTGCAATTGGGTCGTTGCGATTACGGGTTGGCTGTCTAATTGTCCANGCGGTAATGATAGTATCTTGTACCT
GAACCGGTGGCTCACTTTTTCTAAGTAATGGGGAAGAGGACTGAAACATGCCACTGAAAGACTCTACTGAGACAAAAAGATGGGCTGTCAAAAAGGTANA
GGAGGTAGGATGGGCAGTTGGTCAGATCTAGTATGGATCGTACATGGACGATAGTTGGAGTCGGCGGCTCTCCTAGGCTTCCCTCATCTGGGATCCCTGG
GGAAGAGGATCAAGTTGGCCCTTGCGAATAACTTGATGCACTATCTCCCTTCAACCCTTTGAGCGAAATGTANCAAAAGGAAGGAAAATCCATGGACCGA
CCCCATTGTCTCCACCCCGTANGAACTACNANATCACCCCAAGGACGCCCTCGGCGTCCANGGGTCACGGACCGACCCATANACCCTGTTCAATAANTG
page-top