Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp8n17
Contig Information
Length 175 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp8n17   
Homology (BLAST) Top Hit hypothetical protein OsJ_016107 [Oryza sativa (japonica cultivar-group)]
Score 116
Evalue 3.77598e-10
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp8n17
GTCTGGCGCTGGTGGCCGGCAGCCTGCGCCGGACAGTCTCTCGCGAAGTGCCCAGGCTGATTACATTTGAAACACAGACCANTGTTGGCGTTGCCGCCAA
CCGAAGTAACTGTANGAGGCACCCTGCCCTGGACAGTCTCTTGAAAAGTGCCCANGCTGGTTACATTTGAAACAC
page-top