Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10d23
Contig Information
Length 490 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10d23   
Homology (BLAST) Top Hit hypothetical protein OsI_38153 [Oryza sativa Indica Group]
Score 119
Evalue 6.84226e-14
Total Hit Count 51
Registered year 2003
Contig Sequence     [ Download ]
>whdp10d23
GTCGCAGCCTGGCCCTTTCGGTGGCTCTTCTGTAGCAACAGCTCAATCAGCTCCGTATTCAGGAGCTCCGCCACCACCGTTTGGCGGGCCGCCTGGGGCA
GTGCCTCTCCCGGCGTACTCCGGAGGGCCGATCCCCCCGTTTGGGGCTGCACCGGCGCCCTTGCAGCAGGGTCCTTATGGCGGGCCTCCCCAGTTTGGGG
GGCAGAGACCAGGATTGCAGCCTCCGCCATTTGGGGCTCAGACTGCTCCTGCATCTCAGCCACCACCGTTCATGGGGGTTCCTGGGGCTAATGCACCAGC
ATTTGNGCCTCCAGGGTGGCAAAGGCAGGCACNGCCAGGAGCCGTGAGAATGCCTGGTGGNATGCCGCCTAATGCACTAGGCCACGGNGATGCCGTCCAC
ANCCACCATGCCATACTCTCCCCATGCTGNANCCCANGTCTCTACGCCATCCAATATTGACCCTAATCANATTCCGCNNNNTATCGCCGA
page-top