Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10d17
Contig Information
Length 718 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10d17   
Homology (BLAST) Top Hit hypothetical protein OsI_00313 [Oryza sativa Indica Group]
Score 327
Evalue 9.75972e-29
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>whdp10d17
ATGAAGCGAGACATGCCGGTGGGAACTGATGCCGCCAGCTATCGCGCTCCAGCGCCAGCTCCGGATGCTGCCGCATCGGCAGCCGCTGCACAGCCACCGC
CTGGTTATGTCTATGCGCAGATGCAGCCACAACAGCAGTTACAGCAGCCACCTCAGCAGCAATTACAGCAGCAGCAGCAATTACAGCAGCAGCAGCAGTT
ACAACAGCAAGCTCAGCAGCAATTGCCACAACAAATACAGCAGCAGCCACAGCAGCAATTGCCGCCGCAATTACAGCAGCAAGCACAGCAGCAGCCTCCG
CAGCCGCAGCAAGCACACCAGCCAGCTCCACAGCAATATGTCACCGCTGGAAATCAGCATTTCATTCACAACCCAGCCACGGGCACATTCATTCCAATCC
AATCTTATTACCAACAGACTGTCCCTCAGCAAGCGCCGCAGCAACAGCAGTCGCCTGCATTTGACCCAAATACTGGCATGTATTACATCCCTATGCAGCG
TCCAAATGCACCTCAGCAGTATACCATTCCTGCTGGTGCGGTAGCCCCTATGGCTGCTCCGACACTTGTTGACAGCGTACCGAAGCCAACCGTGCCGATT
CCTCAGCAATATATGAAGCCTGAATTGCAGCAACCTGGCATGTACCGAACCGCGGCACCTGCTGCCGCTGCTCCAGGGCCTAACACGACCCCTAATTATG
CTGGAATGGGGTACCACC
page-top