Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10m12
Contig Information
Length 346 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10m12   
Homology (BLAST) Top Hit alpha tubulin 5 [Hordeum vulgare subsp. vulgare]
Score 422
Evalue 3.54919e-40
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10m12
TCGCCTTCGTCCTCGNCGTCTTCACCCTCAGCTCCGACCTCCTCGTAGTCCTTCTCCAGCGCGGCCAGATCCTCCCTGGCCTCCGAGAACTCCCCCTCCT
CCATCCCTTCCCCGACGTACCAGTGCACGAACGCGCGCTTGGCGTACATGAGGTCGAACTTGCGGTCGATGCGCGAGAAGACCTCGGCCACGGCCGTGTT
GTTGCTGATCATGCACACCGCCCGGCGCACCTTGGCCAGGTCCCCTCCCGGAACCACCGTCGGCGGNTGGTANTTTATCCCNCACTTGAANCCNNNCNGG
CNCCNATCNANNAANTGNNCGGNCCTCTTGGNCTTGATGGANNGNA
page-top