Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10d07
Contig Information
Length 608 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10d07   
Homology (BLAST) Top Hit Os03g0804100 [Oryza sativa (japonica cultivar-group)] >gi|41469413|gb|AAS07236.1| hypothetical protein [Oryza sativa (japonica cultivar-group)] >gi|108711623|gb|ABF99418.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113550087|dbj|BAF13530.1| Os03g0804100 [Oryza sativa (japonica cultivar-group)] >gi|125546098|gb|EAY92237.1| hypothetical protein OsI_13957 [Oryza sativa Indica Group] >gi|125588299|gb|EAZ28963.1| hypothetical protein OsJ_012446 [Oryza sativa (japonica cultivar-group)]
Score 352
Evalue 8.55848e-32
Total Hit Count 45
Registered year 2003
Contig Sequence     [ Download ]
>whdp10d07
TGTTCTTGTCATGGTGGAGCCTGAGGGTGTGGTTGCAAAGCCAAATGTGCCAGAGCGAGAGCTTGCCCTGTTCAACATTGTTTGCGACGAACTTTTGCTG
GGGATCCCACTTTTTGCCTGGTGGGTGGGAACTGCAGCATTAATTTGCATTGTGCTGGCATCAATAGCACCATATTTCCTTCCGCTGCACAAGCTACTTA
ACTATGAAGCTGCAGAATTGAGCAGCGTTGATGCAGCTAAGCTTTCCTGATAACGCCGAAACGTGAACTATGAATGTTCAGTTTTGTATAGCAGGCTAGT
AATATACATCGGTACATGTACAGATGTGAAGTTTTTAAGCTCGAGCTCAAATGCTCCCGTGTGAACAGTAAATTTGAAAAAAAATCGAAAAAAATTCAAA
AAATTCTGAATTTTTTTTGTGGCAAACTTTAAAGAATGTTGGANTGCATGCNAAAATTCATCACAAAATCACATCANTGCAAGGCGTGGTANAAAACNAA
ATCNATACTATGAAAATGTTACTTTCAAATGCNTTTTGGGCGCTGATATTTTTTTTGCCATGACTTGCTCCATGNNATTTCCNNGATGAAAATTTNCATG
CNCTTCNA
page-top