Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp20n17
Contig Information
Length 711 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp20n17   
Homology (BLAST) Top Hit Os09g0534800 [Oryza sativa (japonica cultivar-group)] >gi|21362998|sp|Q8W0W3|TF2B_ORYSJ Transcription initiation factor IIB (General transcription factor TFIIB) >gi|18481632|gb|AAL73491.1|AF464908_1 general transcription factor TFIIB [Oryza sativa] >gi|50725809|dbj|BAD33339.1| Transcription initiation factor IIB [Oryza sativa Japonica Group] >gi|50726577|dbj|BAD34211.1| Transcription initiation factor IIB [Oryza sativa Japonica Group] >gi|113632008|dbj|BAF25689.1| Os09g0534800 [Oryza sativa (japonica cultivar-group)] >gi|125564497|gb|EAZ09877.1| hypothetical protein OsI_32170 [Oryza sativa Indica Group] >gi|125606444|gb|EAZ45480.1| hypothetical protein OsJ_028963 [Oryza sativa (japonica cultivar-group)]
Score 839
Evalue 4.04958e-88
Total Hit Count 452
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp20n17
CGAATCCGACAGGGTCCACGCCACATAAAATTAGGCGGGGGATATACATGGGCCTGGTGAAGCACTCACAACAACGAAACTCCCCTCCGACAAATCTAAT
TTTCAAAAGTTATGTAACAAGAAAAAGAGCGAGAGAAAGGAAGAAATGGCTGCGACTCGGCTCCTATGGTGTGCACAGGTTCTTCAGGTCTTCCTCCTTG
GCGTACGAGTTCGGGATGAGCCTCGCGGCGTAGGGGTACAGGTCCTTGTATGAATTCCTGATGGTGCCTTCTGCCACTCCGGTGGCCAAGGAGATATCTT
TAAGTGGCTTTTTGTCCTCTGAAAGCTGGGTTATCATATAAATGACAGCAGCCGCAATTGAAATAGGACTCCTCCTTATATCAAGCTCCTCTGAGCGCTG
AACTGCCTCCTGAGCTGCTTTAACAGCAGTATTGTTCATCCCAAGAGTTGAACAGAAACGCCTCAGGAAATCTCCAGCATGGATGGTTCCCATCTCCATA
GATTGGCCCATCTCAACTTCCAGCTGTTTCACTATGAACTCTTTTGCTCGACCAATCTCTTTCTTTGTTGCTCCATTGGCAACTGAGCAAATTTCTTTTA
CAGTCCTAGGACGATCTTCTTGTCTACAAGCAATATACAGACAAGCAGCTAATATAGCATCTTGATTTCTTCCCCNTGATANACTTGAGATCTTCCNCCT
TCTTATANATT
page-top