Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10m02
Contig Information
Length 148 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10m02   
Homology (BLAST) Top Hit putative small basic membrane integral protein [Oryza sativa Japonica Group] (no hit)
Score 550
Evalue 8.76198e-55
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10m02
GAGGCGGCGGAAATGCGGTTACAATATCAAAACCTTACGTCTCAATGGGCGAAATGCGAAATACCCATGAGCTTCTTCTAGTTCTTAATCTCGACGTCGT
TCAGCCCCCCTCTCGGGCTACTGGCATTGCTCGGCGGCTCATACTCCT
page-top