Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1737
Contig Information
Length 1364 bp
Tissue Callus
Clones 4 Clones [Download: CSV  ,  FASTA ]
whcs10a19    whcs8p12    rwhcs10a19    rwhcs8p12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit casein protein kinase 2 alpha subunit [Lolium perenne]
Score 1651
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1737
TGTTGAACCCTAGCGCCATCTCGCCGCCGGCGATGTCCGCTTGACGGACGCGCCGCCGAGAAAGCACCAAACTCCTCCGAGCCCTCCCATCTCTCTGATC
CGTCGCCCGCCCGCGGGATCCGGATCGTCTTCAGCCATGTCAAAGGCCAGGGTCTACGCCGACGTTAACGTGGTGCGCCCCAAGGAGTACTGGGATTATG
AGGCCCTCGCCGTCCAGTGGGGTGAGCAGGATGACTATGAAGTTGTGCGGAAAGTTGGAAGGGGCAAATACAGTGAAGTCTTTGAAGGTATCAACGTCAA
CAATAATGAGAAATGTGTTATTAAGATCCTGAAGCCTGTGAAGAAGAAGAAGATCAAAAGAGAGATCAAAATACTACAGAATCTCTGTGGAGGTCCAAAT
ATTGTGAAGCTGCTTGATATTGTCAGGGATCAGCATTCAAAAACACCAAGCTTGATCTTTGAATACATCAATAACACAGATTTCAAAGTGCTATATCCGA
CATTGACAGATTATGACATTCGCTACTATATCTATGAGTTACTGAAGGCTTTGGATTACTGCCATTCACAAGGCATTATGCACCGAGATGTGAAGCCTCA
CAATGTTATGATAGATCATGAGCTTCGAAAACTCCGGTTAATAGACTGGGGCCTTGCTGAATTCTACCATCCTGGAAAGGAGTATAACGTTCGTGTTGCA
TCAAGGTACTTCAAGGGACCTGAGCTTCTTGTTGACTTGCAAGATTACGACTACTCTTTGGACATGTGGAGTCTTGGCTGCATGTTTGCTGGAATGATAT
TCCGCAAGGAACCATTTTTCTATGGCCATGACAACCATGACCAACTTGTTAAAATTGCAAAGGTACTTGGAACAGATGGGCTAAATGCTTATTTGAACAA
GTACAGAATTGAGCTTGACCCTCAGCTTGAAGCCCTTGTTGGAAGGCACAGCAGAAAACCCTGGTCAAAGTTTATCAATGCAGACAACCAGCATCTAGTA
TCCCCTGAGGCCATAGATTTCCTTGATAAGCTTCTGCGCTATGATCACCAGGATAGGCTTACTGCACGTGAAGCTATGGCACATCCATACTTCCTCCAGG
TGAGGGCTGCCGAAAACAGCAGGACTCGTGCGCAATAGCAATAGCAAGACTGTTGCTGATATTGAACGAGCAGCACTTGACGAAGCCGCATCCTTGTAGT
GACTTTGTCATGTATTATGACTCGATAATGGTTGGGTCAGCTGGGAAAGGTAAGAGCCTGTGTGGTGTGTGCCTCATCGACGAGGCGGAAAAGAACTGTG
ATTTGCTCCTGTTGTTTGTGTATGGAAACCAGATTGATTGAAACTTCGCAACACACTTTTCATG
page-top